View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0989-Insertion-18 (Length: 65)
Name: NF0989-Insertion-18
Description: NF0989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0989-Insertion-18 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 58; Significance: 3e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 3e-25
Query Start/End: Original strand, 8 - 65
Target Start/End: Original strand, 54849957 - 54850014
Alignment:
| Q |
8 |
cttcaatctttgcaatttttcgcattgaacattacttgttagtgtgtttttggtttca |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54849957 |
cttcaatctttgcaatttttcgcattgaacattacttgttagtgtgtttttggtttca |
54850014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University