View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0989_low_6 (Length: 250)
Name: NF0989_low_6
Description: NF0989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0989_low_6 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 12 - 250
Target Start/End: Complemental strand, 10599491 - 10599253
Alignment:
| Q |
12 |
atgaacgggaagctatgagattgtttagcgatatgttgcttcagggttgtgttgcgccaaattgctttacgttttctggtgttcttaaggcttgtgcgag |
111 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||||||| |||||||||| || ||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
10599491 |
atgaacgggaagctatgagaatgtttagtaatatgttgcttcagggtggtgttgcgccgaactgctttacgttctccggtgttcttaaggcttgtgcgag |
10599392 |
T |
 |
| Q |
112 |
tcttcctaattttgattttggtgaacaagttcacgggcaaacgattaaattaggtctttctgcgattgattgtgtagggaatggtcttgttagtgtgtat |
211 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10599391 |
tcttcctgattttgattttggtgaacaggttcatgggcaaacgattaaattaggtctttctgcaattgattgtgtagggaatggtcttgttagtgtgtat |
10599292 |
T |
 |
| Q |
212 |
gcaaggtctgggagaatggaaggtgctcgcaagtgtttt |
250 |
Q |
| |
|
|||| |||||| ||||||||| |||||||||||||||| |
|
|
| T |
10599291 |
gcaaagtctggaagaatggaatctgctcgcaagtgtttt |
10599253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University