View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0991_low_11 (Length: 287)
Name: NF0991_low_11
Description: NF0991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0991_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 272
Target Start/End: Complemental strand, 6588614 - 6588344
Alignment:
| Q |
1 |
ctgttattgctggtttcgcctttggtttcttggtatgaaaagttttctcatctccgctttattattacattacacttannnnnnnnctttaaggagacta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6588614 |
ctgttattgctggtttcgcctttggtttcttagtatgaaaagttttctcatctccactttattattacattacactt-ttttttttctttaaggagacta |
6588516 |
T |
 |
| Q |
101 |
acgacaaaactcgtgcacattaaaaaatgttgagttgagtggaattgtgtgttagaacgcac-ggtgtacggacaagttacacttatctttaactagtac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6588515 |
acgacaaaactcgtgcacattaaaaaatgttgagttgagtgg-attgtgtgttagaacgcacgggtgtacggactagttacacttatctttaactagtaa |
6588417 |
T |
 |
| Q |
200 |
atttgtttttatcnnnnnnnttgtatcctaaattttatgatttataaaattgtttttgtttttggttggcaac |
272 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6588416 |
atttgtttttatcaaaaaaattgtatcctaaattttatgattgataaaattgtttttgtttttggttggcaac |
6588344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University