View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0991_low_12 (Length: 281)
Name: NF0991_low_12
Description: NF0991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0991_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 3 - 259
Target Start/End: Original strand, 19345254 - 19345510
Alignment:
| Q |
3 |
gatgctatttggtctgattttagccagaaatggttcactctgatgcactccacaaggcctttcatttttagagattatcaagagattgcagatcatgtaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19345254 |
gatgctatttggtctgattttagccagaaatggttcactctgatgcactccacaaggcctttcatttttagagattatcaagagattgcagatcatgtaa |
19345353 |
T |
 |
| Q |
103 |
gcctaattagtccctacatttattggttcaaccactatttttgaagactgaatctttgtcctaattttcctaggctgctgcagctttggagggtgttaga |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19345354 |
gcctaattagtccctacatttattggttcaaccactatttttgaagactgaatctttgccctaattttcctaggctgctgcagctttggagggtgttaga |
19345453 |
T |
 |
| Q |
203 |
gatataacccttgcttctcacctcataggagatatgagtggctctaccattgatgat |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19345454 |
gatataacccttgcttctcacctcataggagatatgagtggctctaccattgatgat |
19345510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University