View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0991_low_14 (Length: 272)
Name: NF0991_low_14
Description: NF0991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0991_low_14 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 30 - 272
Target Start/End: Original strand, 19344762 - 19345004
Alignment:
| Q |
30 |
attacttcccataaatgatgatttatcactcctgtttttggttaaacatatatagcattatggcattgaataggatgatggagttgaagttagacacggg |
129 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19344762 |
attacttcccataattgatgatttatcactcctgtttttggttaaacatatatagcattatggcattgaataggatgatggagttgaagttagacacggg |
19344861 |
T |
|
| Q |
130 |
gcattaggtcttcgacagctggggatagcagcgacacactgtaaacttgagcctatggttgcaaattttatgaaggttttgtgcagccaggagatctata |
229 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19344862 |
gcattaggtcttcggcagctggggatagcagcgacacactgtaaacttgagcctatggttgcaaattttatgaaggttttgtgcagccaggagatctata |
19344961 |
T |
|
| Q |
230 |
agtaagcacagtaactcaacactactttgaatgattcttacct |
272 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19344962 |
agtaagcacagtaactcaaaactactttgaatgattcttacct |
19345004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University