View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0991_low_16 (Length: 234)
Name: NF0991_low_16
Description: NF0991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0991_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 4831239 - 4831035
Alignment:
| Q |
1 |
agaaggagattctccattaggactagaactattgaaggaagcaaaagcattattattagggtttggtaaatggtaaagaaggcacaatccagcattagca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4831239 |
agaaggagattctccattaggactagaactattgaaggaagcaaaagcattattattagggtttggtaaatggtaaagaaggcacaatccagcattagca |
4831140 |
T |
 |
| Q |
101 |
acaaggtcttgtggaggaatatttatgaatggtgatgaaggatgagatgaatttaacggtggttgggtttgatggagacgagcacggtcgcggcggtgaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4831139 |
acaaggtcttgtggaggaatatttatgaatggtgatgaaggatgagaagaatttaacggtggttgggtttgatggagacgagcacggtcgcggcggtgaa |
4831040 |
T |
 |
| Q |
201 |
cattc |
205 |
Q |
| |
|
||||| |
|
|
| T |
4831039 |
cattc |
4831035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University