View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0992_low_2 (Length: 386)
Name: NF0992_low_2
Description: NF0992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0992_low_2 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 1e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 96 - 223
Target Start/End: Complemental strand, 38299119 - 38298992
Alignment:
| Q |
96 |
atttcccacctctccaatcttaatttagagcaatgatttgataaaattgcatatgttgatatatattcaaataaaatatcaaatttgttgatttcaaatt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38299119 |
atttcccacctctccaatcttaatttagagcaatgatttgataaaattgtatatgttgatatatattcaaataaaatatcaaatttgttgatttcaaatt |
38299020 |
T |
 |
| Q |
196 |
caccggtcaaaatgcagtaatattatat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
38299019 |
caccggtcaaaatgcagtaatattatat |
38298992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 76; Significance: 5e-35; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 303 - 386
Target Start/End: Original strand, 6486275 - 6486358
Alignment:
| Q |
303 |
gtgaaccgattagtgaattctgtggaggtgtgtcttcatgttgtgaccattgtggctttgagaatggtgaatttgttgtttgat |
386 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486275 |
gtgaaccaattagtgaattctgtggaggcgtgtcttcatgttgtgaccattgtggctttgagaatggtgaatttgttgtttgat |
6486358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University