View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0993_low_7 (Length: 252)
Name: NF0993_low_7
Description: NF0993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0993_low_7 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 83 - 252
Target Start/End: Complemental strand, 26315980 - 26315808
Alignment:
| Q |
83 |
ttttgaattgtatcctttctttacgtgcnnnnnnn-gcatgtcttgtgctacgtattgtagtataataaattcttggttttctcaaaaacaaacaaaata |
181 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
26315980 |
ttttgaattgtatcctttctttacgtgcttatatttgcatgtcttgtgctacgtattgcagtataataaattcttggtttttttaaaaacaaacaaaata |
26315881 |
T |
|
| Q |
182 |
tttctctgtcacc--attatggctattattgtagtggttttcgactttgacaaaaccattatcgaatgtgaca |
252 |
Q |
| |
|
||||| ||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26315880 |
tttctttgtcaccatattatggctagtattgtagtggttttcgactttgacaaaaccattattgaatgtgaca |
26315808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 195 - 252
Target Start/End: Complemental strand, 43110973 - 43110916
Alignment:
| Q |
195 |
attatggctattattgtagtggttttcgactttgacaaaaccattatcgaatgtgaca |
252 |
Q |
| |
|
|||||||||| |||||| |||||||| ||||||||||||||||| | |||||||||| |
|
|
| T |
43110973 |
attatggctaatattgttgtggtttttgactttgacaaaaccatagttgaatgtgaca |
43110916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University