View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0994_low_4 (Length: 216)
Name: NF0994_low_4
Description: NF0994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0994_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 82 - 149
Target Start/End: Complemental strand, 23345271 - 23345204
Alignment:
| Q |
82 |
caaagatatgagagaaattattgatttttattttgaggggacaaataattgatttattgaaatgggtg |
149 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23345271 |
caaaaatatgagagaaattattgatttttattttgaggggacaaataattgatttattgaaatgggtg |
23345204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 179 - 212
Target Start/End: Complemental strand, 23345174 - 23345141
Alignment:
| Q |
179 |
tcctaaaatactatttcgtcattactaatggtat |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
23345174 |
tcctaaaatactatctcgtcattactaatggtat |
23345141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University