View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0995-Insertion-13 (Length: 179)
Name: NF0995-Insertion-13
Description: NF0995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0995-Insertion-13 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 6e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 8 - 179
Target Start/End: Original strand, 52911606 - 52911777
Alignment:
Q |
8 |
caagggattctacaaattttgtcagaaaacgaaaacgtattgataaaatttaatgcatgaactcaaagaaggagcgaggaaagctacaaacatgaactca |
107 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52911606 |
caagggattatacaaattttgtcagaaaacgaaaacgtattgataaaatttaatgcatgaactcaaagaaggagcgaggaaagctacaaacatgaactca |
52911705 |
T |
 |
Q |
108 |
tgcgtgtgtgtgtgctaggtaaagcttgctaaagctattccggtaatgtcatggatgcatgtgtgtttatag |
179 |
Q |
|
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52911706 |
tgcatgtgtgtgtgctaggtaaagcttgctaaagctattccggtaatgtcatggatgcatgtgtgtttatag |
52911777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University