View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0995-Insertion-15 (Length: 45)
Name: NF0995-Insertion-15
Description: NF0995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0995-Insertion-15 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 38; Significance: 0.0000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.0000000000002
Query Start/End: Original strand, 8 - 45
Target Start/End: Complemental strand, 6293525 - 6293488
Alignment:
| Q |
8 |
actaagacattgggtaatcttccattcttcccatttaa |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6293525 |
actaagacattgggtaatcttccattcttcccatttaa |
6293488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University