View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0996_low_2 (Length: 283)
Name: NF0996_low_2
Description: NF0996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0996_low_2 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 21 - 283
Target Start/End: Original strand, 36605089 - 36605350
Alignment:
Q |
21 |
aatattctgagaataagagcgaaatgaaaatttgcagaggcgagataataaagcgtgaatttacggtacctggtagagactcttttgaggttgatcttca |
120 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36605089 |
aatattctgagaataagagcgaaatgaaaatttgcagaggcgagataataaagcgtgaatttacggtacctggtagagactcttttgaggttgatcttca |
36605188 |
T |
 |
Q |
121 |
atttcttcatcatcggaaaccctagatttcttattcggcgccatttttcacacagagagatttgtttgatggatttgatagtgcgttattgtgtttgttt |
220 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
36605189 |
atttcttcatcatcggaaaccctagatttcttattcggcgccatttttcacacagagagatttgtttgatggatttgatagtgcgttattgtgtttg-tt |
36605287 |
T |
 |
Q |
221 |
ttaaactcaattaatcgatttttaaacaaaaagtttgtggttgttcccgctataatttacgat |
283 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36605288 |
ttaaactcaattaatcgatttttaaacaaaaagtttgtggttgttcccgctataatttacgat |
36605350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University