View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0999-INSERTION-14 (Length: 300)
Name: NF0999-INSERTION-14
Description: NF0999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0999-INSERTION-14 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 11 - 300
Target Start/End: Complemental strand, 29147637 - 29147340
Alignment:
| Q |
11 |
acttctccaaaccataacaatttttcaaaattccattgatgatactattctccatagccaacttcttcaacttcaagattttcagcttttcacaactttg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29147637 |
acttctccaaaccataacaatttttcaaaattccattgatgatactattctccatagccaacttcttcaacttcaaaattttcagcttttcacaactttg |
29147538 |
T |
 |
| Q |
111 |
aaaagcgagtaaagctgattttgtcagtttataatttgtcaactcaagtgaacataaattcgaaattattttaggcttaagataatc--------ataac |
202 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
29147537 |
aaaagcaagtaaagctgattttgtcagtttataatttgtcaactcaagcgaacataaattcaaaattattttaggcttaagataatcataagttcataac |
29147438 |
T |
 |
| Q |
203 |
catccttcaaaaatctgctacgctcgtcgttcaaaaatctgttaggctcatatattgaagttttacactctaaactcaaacaagttagcttttttctc |
300 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29147437 |
catccttcaaaaatctgctacgctcgttgttcaaaaatctgttacgctcatatattgaagttttacactctaaactcaaacaagttagcttttttctc |
29147340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 9 - 51
Target Start/End: Original strand, 6953561 - 6953603
Alignment:
| Q |
9 |
aaacttctccaaaccataacaatttttcaaaattccattgatg |
51 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
6953561 |
aaacttctccaaaccaacacaattttccaaaattccattgatg |
6953603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University