View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0999-INSERTION-19 (Length: 55)
Name: NF0999-INSERTION-19
Description: NF0999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0999-INSERTION-19 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 41; Significance: 0.000000000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.000000000000004
Query Start/End: Original strand, 7 - 55
Target Start/End: Complemental strand, 33051302 - 33051254
Alignment:
Q |
7 |
aataaagaatatggtgatatatagttacgttgttaacacttcatatatt |
55 |
Q |
|
|
|||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
T |
33051302 |
aataaagaatatggtgatatatagttacattgttaacacttcagatatt |
33051254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University