View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0999-INSERTION-21 (Length: 106)
Name: NF0999-INSERTION-21
Description: NF0999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0999-INSERTION-21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 67; Significance: 3e-30; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 3e-30
Query Start/End: Original strand, 8 - 78
Target Start/End: Original strand, 52564765 - 52564835
Alignment:
Q |
8 |
cattcaatatcttcgtccgtcatgcctcttgatcttaatcaagatcaaaacaatgacctttctagtccaaa |
78 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
52564765 |
cattcaatatcttcgtccgtcatgcctcttgatcttaatcaagatcaaaaccatgacctttctagtccaaa |
52564835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University