View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0999-INSERTION-27 (Length: 441)
Name: NF0999-INSERTION-27
Description: NF0999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0999-INSERTION-27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 394; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 394; E-Value: 0
Query Start/End: Original strand, 8 - 429
Target Start/End: Original strand, 3863410 - 3863831
Alignment:
Q |
8 |
atcacttgctttgtacttccggatatgtcccatcagtccgaactccgaatcataccagctcatgattgttatcacaaatacatgtaaaccagcaccaaca |
107 |
Q |
|
|
|||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3863410 |
atcacttgctttgtgcttccggatatgtcccatctgtccgaactccgaatcataccagctcatgattgttatcacaaatacatgtaaaccagcaccaaca |
3863509 |
T |
 |
Q |
108 |
cggtattgttgcatgcttattatagaaattgcgattgaaagaaataatggaatctgcaatagcttcttatttggcaatattagtttatgatttatgtggc |
207 |
Q |
|
|
||||| ||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3863510 |
cggtagtgttgcatgcttattttagaaattgcgatggaaagaaataatggaatctgcaatagcttcttatttggcaatattagtttatgatttatgtggc |
3863609 |
T |
 |
Q |
208 |
cttttgttggaggcaccatcacatattaaggagtctatgaacaactgtgtttttaattatttgatcaataagtttatcatatctcgttcaatcaaatagt |
307 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3863610 |
cttttgttggaggcaccatcacatattaaggagtctatgaacaactgtgtttttaattatttgatcaataagtttatcatatctcgttcaatcaaatagt |
3863709 |
T |
 |
Q |
308 |
gtgatttactacttatccaatagtagaagttaatttgtgtatgatgtaggatttattttatttgcacatcatagaattgacatatactacttcaatattt |
407 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3863710 |
gtgatttactacttatccaatagtagaagttaatttgtgtatgatgcaggatttatcttatttgcacatcatagaattgacatatactacttcaatattt |
3863809 |
T |
 |
Q |
408 |
aatacctctcttgagtgtggtt |
429 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
3863810 |
aatacctctcttgagtgtggtt |
3863831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University