View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0999-INSERTION-4 (Length: 121)
Name: NF0999-INSERTION-4
Description: NF0999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0999-INSERTION-4 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 6e-44; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 6e-44
Query Start/End: Original strand, 8 - 121
Target Start/End: Complemental strand, 75264 - 75151
Alignment:
| Q |
8 |
gcttattgggttaggctgcagttaaattaaaaaagtaaaattaattacttctgaactgagggaaaacctaaaccatatactttttnnnnnnnntcaggta |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
75264 |
gcttattgggttaggctgcagttaaattaaaaaagtaaaattaattacttctgaactgagggaaaacctaaaccatatactttttaaaaaaaatcaggta |
75165 |
T |
 |
| Q |
108 |
ctggctgtaaaaaa |
121 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
75164 |
ctggctgtaaaaaa |
75151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University