View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10002_high_16 (Length: 226)

Name: NF10002_high_16
Description: NF10002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10002_high_16
NF10002_high_16
[»] chr3 (1 HSPs)
chr3 (1-226)||(52891274-52891499)


Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 52891499 - 52891274
Alignment:
1 aggtggttccgacggaaacaagattgaacgtgctggagaagtgctttgtggctgagctttcatatcacagggaggcaaagtcagtgcaaaatagcttagt 100  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52891499 aggtggttccgacggaaacaagattgaaggtgctggagaagtgctttgtggctgagctttcatatcacagggaggcaaagtcagtgcaaaatagcttagt 52891400  T
101 gatggaagggattaagaatgttagggtgacaactatgggtgataatctggtgctactgcaagtcgaggatccggtgcgattcgaactagataggaaggaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
52891399 gatggaagggattaagaatgttagggtgacaactatgggtgataatctggtgctactgcaagtggaggatccggtgcgattcgaactagataggaaggaa 52891300  T
201 catgggcagtggtggtcagttgtgtt 226  Q
    ||||||||||||||||||||||||||    
52891299 catgggcagtggtggtcagttgtgtt 52891274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University