View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10002_high_6 (Length: 290)
Name: NF10002_high_6
Description: NF10002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10002_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 11 - 273
Target Start/End: Original strand, 43327040 - 43327308
Alignment:
| Q |
11 |
cagagatgagtccagtccgaagcatctgaggtatggatgcaatcaaaagatatgatgcaagcatggctggccaaaacccagcagtagggataccaaactt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43327040 |
cagagatgagtccagtccgaagcatctgaggtatggatgcaatcaaaagatatgatgcaagcatggctggccaaaacccagcagtagggataccaaactt |
43327139 |
T |
 |
| Q |
111 |
gcttgccacttgtatggcccaagatgccaacaagtcaaccaccaccaaacatacatcatcaa------gattttgattttgaagaaactcttcaaaatgg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43327140 |
gcttgccacttgtatggcccaagatgccaacaagtcaaccacaaccaaacatacatcatcaagattttgattttgattttgaagaaactcttcaaaatgg |
43327239 |
T |
 |
| Q |
205 |
tttggcattatactctccatggatgattcaatggcaaagaaatctggtgttgtactgtcctcttccatc |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43327240 |
tttggcattatactctccatggatgattcaatggcaaagaaatctggtgttgtactgtcctcttccatc |
43327308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University