View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10002_low_16 (Length: 234)
Name: NF10002_low_16
Description: NF10002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10002_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 17 - 218
Target Start/End: Complemental strand, 28241770 - 28241569
Alignment:
| Q |
17 |
atagaaatacaatattgttcatgataaaatattatgatgtcgtttgatctatt-agccgacaccacttagtatcccacacttagtcattggtatgtaaca |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28241770 |
atagaaatacaatattgttcatgataaaataatat-atgtcgtttgatctatttagccgacaccacttagtatcccacacttagtcattggtatgtaaca |
28241672 |
T |
|
| Q |
116 |
ttgatttttcatgttcaaattttggtctataatgtcatgtattcttcccaattcttacaaatgtatctgctcttatctttaacttctagcataccgatca |
215 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28241671 |
ttgatttttcatgttctaattttggtctataacgtcacgtattcttcccaattcttacaaatgtatatgctcttatctttaacttctagcataccgatca |
28241572 |
T |
|
| Q |
216 |
tac |
218 |
Q |
| |
|
||| |
|
|
| T |
28241571 |
tac |
28241569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University