View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10002_low_7 (Length: 323)
Name: NF10002_low_7
Description: NF10002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10002_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 26073029 - 26072809
Alignment:
| Q |
1 |
aacataagagtgatgaaaattacagctttggaagaatcccaagaaccaacaagaggaacagaaccataaacatgaggaacaagatgagtagtgagtttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26073029 |
aacataagagtgatgaaaattacagctttggaagaatcccaagaaccaacaagaggaacagaaccataaacatgaggaacaagatgagtagtgagtttga |
26072930 |
T |
 |
| Q |
101 |
gattctccatcttgagagaaacatatagttgtccaccagcttgctcatcatcatcatctgttctgtctttggtttcttctgaattaccatctgtttgctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26072929 |
gattctccatcttgagagaaacatatagttgtccaccagcttgatcatcatcatcatctgttctgtctttggtttcttctgaagtaccatctgtttgctt |
26072830 |
T |
 |
| Q |
201 |
tgatgaaccagttcccatgtt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
26072829 |
tgatgaaccagttcccatgtt |
26072809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 254 - 295
Target Start/End: Complemental strand, 26072774 - 26072733
Alignment:
| Q |
254 |
atgactcagaaataatatgtatatgtatagatatatggatag |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26072774 |
atgactcagaaataatatgtatatgtatagatatatgtatag |
26072733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 273 - 307
Target Start/End: Complemental strand, 26072743 - 26072709
Alignment:
| Q |
273 |
tatatgtatagatatatggatagtggatgaggatg |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
26072743 |
tatatgtatagatatatggatagtggatgaggatg |
26072709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University