View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10003_2 (Length: 441)
Name: NF10003_2
Description: NF10003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10003_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 4 - 254
Target Start/End: Original strand, 6956643 - 6956893
Alignment:
| Q |
4 |
tcactaaacatgaataattacccaaatgtacttttttcttcatgaatttgcttacttatcccacaaggaatgtaaaattaggtttgtattgcttaagtat |
103 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6956643 |
tcactaaacgtgaataattacccaaatgtacttttttcttcatgaatttgcttacttatcccacaaggaatgtcaaattaggtttgtattgcttaagtat |
6956742 |
T |
 |
| Q |
104 |
ctcagtgagcctataattttcttatacaatgtagagtcaactagattctcatcaacatctttgccgagtttgattcccatctccattggtatttctggtg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6956743 |
ctcagtgagcctataattttcttatacaatgtagagtcaactagattctcatcaacatctttgccgagtttgattcccatctctattggtatttctggtg |
6956842 |
T |
 |
| Q |
204 |
gattgcagtgtaacgtgtagaatcgtttcaaaacatcttcaccatatttct |
254 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6956843 |
gattgcagtgtaacgtgtagaatcttttcaaaacatcttcaccatatttct |
6956893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 118; E-Value: 5e-60
Query Start/End: Original strand, 285 - 410
Target Start/End: Original strand, 6958266 - 6958391
Alignment:
| Q |
285 |
gaatctatcttactatgatatggtcattttcaagtaacattatattgtaatatttgattaacacctttagctctctttcaagcaggtttggtttgtggtt |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6958266 |
gaatctatcttactatgatatggtcattttcaagtaacattatattgcaatatttgattaacacctttagctctctttcaagcaggtttggtttgtggtt |
6958365 |
T |
 |
| Q |
385 |
tctagattacatcaatataagtgtta |
410 |
Q |
| |
|
|||||||||||||| ||||||||||| |
|
|
| T |
6958366 |
tctagattacatcagtataagtgtta |
6958391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University