View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10005_high_9 (Length: 229)
Name: NF10005_high_9
Description: NF10005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10005_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 13 - 212
Target Start/End: Complemental strand, 35798714 - 35798515
Alignment:
Q |
13 |
caaaggcatataaaggaacaacaaagtaatatagaagcaatattagcaacaatggagaattcgatgaaacacatggaagaaactaagtatgaacaagttg |
112 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35798714 |
caaaagcatataaaggaacaacaaagtaatatagaagcaatattagcaacaatggagaattcgatgaaacacatggaagaaactaagtatgaacaagttg |
35798615 |
T |
 |
Q |
113 |
gtacatgcagccaaaataggtggcaaaagaagaccaaatgcttagggttagggggtccaaagaggaagaaatgtcatgattcaattgcctactttggaag |
212 |
Q |
|
|
||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
35798614 |
gtaaatgcagccaaaataggtggcaaaaaaagaccaaatgcttagggttagggggtccaaagaggaagaaatgtcaggattcaattgcctactttggaag |
35798515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University