View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10006_low_7 (Length: 261)
Name: NF10006_low_7
Description: NF10006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10006_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 251
Target Start/End: Original strand, 33187707 - 33187946
Alignment:
Q |
19 |
gtgtggaccttgaaagtttgccaaatcttttaattggcaagttgtccatcattaaattaaattgtctttctagttcaatcttaccacatgaaaatttaat |
118 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33187707 |
gtgtggaccttgaaagtttgccaaatcttttaattggcaagttgtccatcattaaattaaattgtctttctagttcaatcttaccacatgaaaatttaat |
33187806 |
T |
 |
Q |
119 |
ttagcaactcatcacatgaaaatttgatttatttgactatatcaaaccgtcagcttataatagaccttttaaca-------tatatacacttttaaacaa |
211 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
T |
33187807 |
ttagcaactcatcacatgaaaaattgatttatttgactatatcaaaccgtcagcttataatagaccttttaacatataaagtatacacacttttaaacaa |
33187906 |
T |
 |
Q |
212 |
accataaaactattttaatttatggtttattctacctatg |
251 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
33187907 |
accataaaactattttaatttatggtttattctacttatg |
33187946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University