View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10007_high_4 (Length: 287)
Name: NF10007_high_4
Description: NF10007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10007_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 7 - 285
Target Start/End: Complemental strand, 55300956 - 55300678
Alignment:
| Q |
7 |
tttggtgttactctctccctcaaatgctttctcttatgctcttcaaccaacaacacaacatcgtcacacaaaattgttttctctggaatagtttctgatt |
106 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55300956 |
tttgatgttactctctccctcaaaggctttctcttatgctcttcaaccaacaacacaacatcgtcacacaaaattgttttctctggaatagtttctgatt |
55300857 |
T |
|
| Q |
107 |
cataattaaccctcaaaggcttcccgccttcaacatcgtcactaccgtcgtccatcttctccaaagttgcttgtgatgatgacggattgttaaccctcaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55300856 |
cataattaaccctcaaaggcttcccgccttcaacatcgtcactaccgtcgtccatcttctccaaagttgcttgtgatgatgacggattgttaaccctcaa |
55300757 |
T |
|
| Q |
207 |
aggcttcccttggatatcgggatggatcaacaccatcgcctcctccaaagttgcttctggttctgttgccatgagtgat |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
55300756 |
aggcttcccttggatatcgggatggatcaacaccatcgcctcctccaaagttgcttctggttctgttaccatgagtgat |
55300678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University