View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10007_high_7 (Length: 215)
Name: NF10007_high_7
Description: NF10007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10007_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 22 - 159
Target Start/End: Complemental strand, 1352965 - 1352827
Alignment:
| Q |
22 |
atcatatttatattagttcttttaacctggggtccaatttaagtgtcttcaaagtatttaagataccatgttagtgttctacacgt-acaaatggtgcca |
120 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || ||||||||||||| |
|
|
| T |
1352965 |
atcatatttatattggttcttttaacctggggtccaatttaagtgtcttcaaagtatttaagatatcatgttagtgttctacatgtaacaaatggtgcca |
1352866 |
T |
 |
| Q |
121 |
tattttctggttctcattttgttaccgttagtgtaatgt |
159 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
1352865 |
tattttctagttctcattttgttaccattagtgtaatgt |
1352827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University