View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10007_low_10 (Length: 228)
Name: NF10007_low_10
Description: NF10007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10007_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 89 - 212
Target Start/End: Complemental strand, 34440315 - 34440187
Alignment:
| Q |
89 |
agttctcagaaaacagtatcctccaaagggcagaaattgggataatttacaccaattatcaaagatttatgagtagttgaaggttgtagttgtagcaaca |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34440315 |
agttctcagaaaacagtatcctccaaagggcagaaattgggataatttacaccaattatcaaagatttatgagtagttgaaggttgtagttgtagcaaca |
34440216 |
T |
 |
| Q |
189 |
ttgat-----atgctaggttgtaacaatg |
212 |
Q |
| |
|
||||| ||||||||||||||||||| |
|
|
| T |
34440215 |
ttgatatgtaatgctaggttgtaacaatg |
34440187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 61 - 105
Target Start/End: Complemental strand, 34440380 - 34440336
Alignment:
| Q |
61 |
ttggggaactaaataaagactactaggcagttctcagaaaacagt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34440380 |
ttggggaactaaataaagactactaggcagttctcagaaaacagt |
34440336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University