View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10007_low_5 (Length: 324)
Name: NF10007_low_5
Description: NF10007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10007_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 14 - 308
Target Start/End: Original strand, 40645878 - 40646172
Alignment:
| Q |
14 |
atagggcaataggtttctatcaaattcactgtcatcagatgcccttatgaggtaaatatgattcctagcatactacattgcagaatcaacaaaaagatac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40645878 |
atagggcaataggtttctatcaaattcactgtcatcagatgcccttatgaggtaaatatgattcctagcatactacattgcagaatcaacaaaaagatac |
40645977 |
T |
 |
| Q |
114 |
ctatatnnnnnnncaatatcttcgatatgagttgactcatcttcaggcctcagtatactcattgtgtagaacttaatttgctcagactgaaataatccaa |
213 |
Q |
| |
|
|||||| |||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40645978 |
ctatataaaaaaacaatatcttcgatatgagttgaatcgtcttcaggcctcagtatactcattgtgtagaacttaatttgctcagactgaaataatccaa |
40646077 |
T |
 |
| Q |
214 |
taaaaccatataaattatcatgtaacaatcaatttagagttttaaaacatccaactccaccataatgaacaagtacaaaaccttggtcaaagaac |
308 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40646078 |
taaaaccatataaactatcatgtaacaatcaatttagagttttaaaacatccaactccaccataatgaacaattacaaaaccttggtcaaagaac |
40646172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University