View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10009_high_4 (Length: 229)
Name: NF10009_high_4
Description: NF10009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10009_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 38 - 219
Target Start/End: Complemental strand, 32810746 - 32810565
Alignment:
| Q |
38 |
gaataagaaatcaaaactgacctannnnnnnagttccattgttctgaaagtgggggaaatattgcgtgtatgcaatcaaaattggtcagtagttactggt |
137 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32810746 |
gaataataaatcaaaactgacctatttttttagttccattgttctgaaagtgggggaaatattgcgtgtatgcaatcaaaattggtcagtagttactggt |
32810647 |
T |
|
| Q |
138 |
tagagatggcatacctctgctgattaaactgccgctatagctattctccgtgtatgttcttgttctacataattactctgtg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32810646 |
tagagatggcatacctctgctgattaaactgccgctatagctattctccgtgtatgttcttgttctacataattactctgtg |
32810565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University