View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10009_low_11 (Length: 250)
Name: NF10009_low_11
Description: NF10009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10009_low_11 |
 |  |
|
[»] scaffold0003 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 6996421 - 6996180
Alignment:
Q |
1 |
cgctcttcaaaagtggacaattcactttagagtgtaaaacaagtaatctcaactatgatgaataaatcaattattgatgttaccaggacatgcatagtaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6996421 |
cgctcttcaaaagtggacaattcactttagagtgtaaaccaagtaatctcaactatgatgaataaatcaattattgatgttaccaggacatgcatagtaa |
6996322 |
T |
 |
Q |
101 |
ttttatgaatgtattaaaatattaaccattgattttcttattaacagttgagattacttgcttcaccttctgttctgatagacaaaaaagttctacattt |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6996321 |
ttttatgaatgtattaaaatattaaccattgattttcttattaacagttgagattacttgcttcaccttctgttctgatagacaaaaaagttctacattt |
6996222 |
T |
 |
Q |
201 |
ctttagaataaaagttaagagaagtttataaaaacctatgct |
242 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
6996221 |
ctttagaataaaggttaagagaagtttataaaaacctatgct |
6996180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 8 - 62
Target Start/End: Complemental strand, 7028812 - 7028758
Alignment:
Q |
8 |
caaaagtggacaattcactttagagtgtaaaacaagtaatctcaactatgatgaa |
62 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
7028812 |
caaaactggacaattcactttagagtgtaaaacaagtaatctcaacaatgatgaa |
7028758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 13 - 52
Target Start/End: Complemental strand, 7057816 - 7057777
Alignment:
Q |
13 |
gtggacaattcactttagagtgtaaaacaagtaatctcaa |
52 |
Q |
|
|
|||||||||| ||||||||| ||||||||||||||||||| |
|
|
T |
7057816 |
gtggacaatttactttagagggtaaaacaagtaatctcaa |
7057777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 15 - 52
Target Start/End: Complemental strand, 7048897 - 7048860
Alignment:
Q |
15 |
ggacaattcactttagagtgtaaaacaagtaatctcaa |
52 |
Q |
|
|
|||||||| ||||||||| ||||||||||||||||||| |
|
|
T |
7048897 |
ggacaatttactttagagggtaaaacaagtaatctcaa |
7048860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 10 - 54
Target Start/End: Complemental strand, 7041802 - 7041758
Alignment:
Q |
10 |
aaagtggacaattcactttagagtgtaaaacaagtaatctcaact |
54 |
Q |
|
|
||||||||||||| ||| ||||| ||||||||||||| ||||||| |
|
|
T |
7041802 |
aaagtggacaatttactctagagggtaaaacaagtaacctcaact |
7041758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 103 - 159
Target Start/End: Complemental strand, 333515 - 333459
Alignment:
Q |
103 |
ttatgaatgtattaaaatattaaccattgattttcttattaacagttgagattactt |
159 |
Q |
|
|
|||| |||||||| |||||| ||| ||||||||||||||||| |||||||||||| |
|
|
T |
333515 |
ttataaatgtattgaaatatcaacaattgattttcttattaatgattgagattactt |
333459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University