View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10009_low_17 (Length: 229)
Name: NF10009_low_17
Description: NF10009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10009_low_17 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 7 - 229
Target Start/End: Original strand, 1241814 - 1242038
Alignment:
| Q |
7 |
gataatccataattcgattgagaggccggtgatgaccgaccaagaatgtttaagttaaggtttgtacttcttcaaaattatcggtcttaactgaagttca |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1241814 |
gataatccataattcgattgagaggccggtgatgaccgaccaagaatgtttaagttaaggtttgtacttcttcaaaattatcggtcttacctgaagttca |
1241913 |
T |
 |
| Q |
107 |
ttgacta--tttgataccaataatttggctactttcaagataaattaacctcataatttagaattcagtagcaatgtaaataaatgttgaccagtaatag |
204 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| | |
|
|
| T |
1241914 |
ttgactatttttgataccaataatttggctattttcaagataaattaacctcataatttagaattcagtagcaatgtaaataaatgttgactaataattg |
1242013 |
T |
 |
| Q |
205 |
tttcggtaaagatttaaactttaat |
229 |
Q |
| |
|
||||||||| ||||||||||||||| |
|
|
| T |
1242014 |
tttcggtaatgatttaaactttaat |
1242038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University