View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10009_low_7 (Length: 360)
Name: NF10009_low_7
Description: NF10009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10009_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 3e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 141 - 269
Target Start/End: Complemental strand, 5555093 - 5554965
Alignment:
| Q |
141 |
acatcttctcaaacttctaattgagtatatacatacattccaactagggggaaataagatagattggctgacaagaacctactgattattctgcatgagg |
240 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5555093 |
acatcttctcaaacttccaattgagtatatacatacattccaactagggggaaataagatagattggctgacaagaacctactgattattctgcatgagg |
5554994 |
T |
 |
| Q |
241 |
cttaaattgggccagactttttctttaag |
269 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5554993 |
cttaaattgggccagactttttctttaag |
5554965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 18 - 149
Target Start/End: Complemental strand, 5555254 - 5555123
Alignment:
| Q |
18 |
gtttagtcatagaaccctatttcttatggcgatgtattgtcttggtcatctgagacttatatttatgtctcttcccctattggatgatgatgtgagtaat |
117 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
5555254 |
gtttggtcatagaaccctatttcttatggcgatgtattgtcttggtcctctgagacttatatttatgtctcttccccaattggataatgatgtgagtaat |
5555155 |
T |
 |
| Q |
118 |
gaattataattagcactaatgccacatcttct |
149 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |
|
|
| T |
5555154 |
gaattattattagcactaatgccacatcttct |
5555123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University