View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1000_high_4 (Length: 306)
Name: NF1000_high_4
Description: NF1000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1000_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 285
Target Start/End: Complemental strand, 49290880 - 49290605
Alignment:
| Q |
1 |
caaagaacttaacaaataaagatataattggaaaatctgatccttttgctgtggtatttgtacgcccactccgtgacaaaaccaaaaccagtaaaataat |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49290880 |
caaagaacttatcaaataaagatataattggaaaatctgatccttttgctgtggtatttgtacgcccactccgtgacaaaaccaaaaccagtaaaataat |
49290781 |
T |
 |
| Q |
101 |
tgtaagtccctatttattattgatttgtttctttatcatnnnnnnnnnnnnnnnngttgcaaatcataatataattattggtcattctcagaacaaccag |
200 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
49290780 |
tgtaagtccctatttatt-------tgtttctttatcattgtgtgtgtgtgtg--gttgcaaatcataatataattattggtcatgctcagaacaaccag |
49290690 |
T |
 |
| Q |
201 |
ttgaacccaatatggaatgagcactttgaattcattattgaagacgaatcaacacaacacttgaccataagaatctttgatgatg |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49290689 |
ttgaacccaatatggaatgagcactttgaattcattattgaagacgaatcaacacaacacttgaccataagaatctttgatgatg |
49290605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University