View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1000_low_10 (Length: 306)
Name: NF1000_low_10
Description: NF1000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1000_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 8e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 139 - 279
Target Start/End: Original strand, 49290992 - 49291123
Alignment:
| Q |
139 |
taatattcaaaacatgtagaaatgacaatgatataattaatttataattccaaaataaaatgcaatacgatcaatacatgccaacaaccaagatagcaat |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49290992 |
taatattcaaaacatgtagaaatgacaatgat---------ttataattccaaaataaaatgcaatacgatcaatacatgccaacaaccaagatagcaat |
49291082 |
T |
 |
| Q |
239 |
caactctctcagaaaattgaagattcatcaacatgaatttg |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49291083 |
caactctctcagaaaattgaagattcatcaacatgaatttg |
49291123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 49290856 - 49290940
Alignment:
| Q |
1 |
atatctttatttgttaagttctttgcctgcactagttttacatctagtgttccaacgggtttcaattctaggttactgtcagatg |
85 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49290856 |
atatctttatttgataagttctttgcctgcactagttttacatctagtgttccaacgggtttcaattctaggttactgtcagatg |
49290940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University