View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1000_low_13 (Length: 251)
Name: NF1000_low_13
Description: NF1000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1000_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 47 - 245
Target Start/End: Original strand, 361160 - 361358
Alignment:
| Q |
47 |
aagatgaactctttaaatctaaatttgatgaccacatcacatccactgaaattattaggcctaaattccttacatgaatatgcgcttaataaaaactgag |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
361160 |
aagatgaactctttaaatctaaatttgatgaccacatcatatccactgaaattattaggcctaaattccttacatgaatatgcgcttaataaaaactgag |
361259 |
T |
 |
| Q |
147 |
gcaaccatacaacacatctagtattaatatattatgtatatataacaaactaagtcaaatacatcagcttaatctagcaatactttcaagaattatcta |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
361260 |
gcaaccatacaacacatctagtattaatatattatgtatatataacaaactaagtcaagtgcatcagcttaatctagcaatactttcaagaatcatcta |
361358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University