View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1001-INSERTION2 (Length: 115)
Name: NF1001-INSERTION2
Description: NF1001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1001-INSERTION2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 3e-42; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 3e-42
Query Start/End: Original strand, 8 - 109
Target Start/End: Complemental strand, 30781345 - 30781243
Alignment:
Q |
8 |
gaatatattctgtcatatgcacatttcagatctacataacaacgtgatatttgcctgtattcgtaattaagaatatattttcctc-aaaacaagctaatt |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |||||| |
|
|
T |
30781345 |
gaatatattctgtcatatgcacatttcagatctacataacaacgtgatatttgcctgtattcgtaattaataatatattttcctcgaaaacaacctaatt |
30781246 |
T |
 |
Q |
107 |
cag |
109 |
Q |
|
|
||| |
|
|
T |
30781245 |
cag |
30781243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University