View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1001-INSERTION3 (Length: 226)
Name: NF1001-INSERTION3
Description: NF1001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1001-INSERTION3 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 8 - 226
Target Start/End: Complemental strand, 49568497 - 49568291
Alignment:
| Q |
8 |
caaaggacaagatatttattgtagcatctctctttatctttggtttttccacttccacgcacagtttacagagacaaacatagaatcattggagccttgc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
49568497 |
caaaggacaagatatttattgtagcatctctctttatctttggtttttccacttccacgcacagtttacagagacaaacatagaattattggagccttgc |
49568398 |
T |
 |
| Q |
108 |
gcggcacaaaatggggaggcaatggaaagagatagggttgacaaggtaccatgttggtggcagcggccgtggcagcttggttgaagagattgcaagttta |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
49568397 |
gcggcacaaaatggggaggcaatggaaagagatagggttgacaaggcaccatgttggtgg------------cagcttggttgaagagattgcaagttta |
49568310 |
T |
 |
| Q |
208 |
gttttcatgctatgtgcag |
226 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
49568309 |
gttttcatgctatgtgcag |
49568291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University