View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1001-INSERTION4 (Length: 266)
Name: NF1001-INSERTION4
Description: NF1001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1001-INSERTION4 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 153 - 266
Target Start/End: Complemental strand, 42357192 - 42357079
Alignment:
| Q |
153 |
gagttgtattgtacaacctacatacttgtcacgcatacaagataagagtaattaacaatatttagaataatgtttaagtgcatgactgagattatatttt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42357192 |
gagttgtattgtacaacctacatacttgtcacgcatacaagataagagtaattaacaatatttagaataatgtttaagtgcatgactgagattatatttt |
42357093 |
T |
 |
| Q |
253 |
tccttagttgtagt |
266 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
42357092 |
tccttagttatagt |
42357079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 36 - 120
Target Start/End: Complemental strand, 42357308 - 42357225
Alignment:
| Q |
36 |
gaaaagtggtccttccttggtcaccagtgctgtcccttactggggagggtgataactgcacatagaaacagaaataatcaacaac |
120 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42357308 |
gaaaagtggtc-ttccttcgtcaccagtgctgtcccttacttgggagggtgataactgcacatagaaacagaaataatcaacaac |
42357225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University