View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10010_low_3 (Length: 268)
Name: NF10010_low_3
Description: NF10010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10010_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 6 - 94
Target Start/End: Original strand, 26000902 - 26000990
Alignment:
| Q |
6 |
agttgactctccattaacacatagagacaatagaaattttccgtcaaataaggcaggcctcaaactagttgctcctggaaaatacattc |
94 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26000902 |
agttgactctccatcaacacatagagacaatagaaattttccgtcaaataaggcaggcctcaaaccagttgctcctggaaaatacattc |
26000990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University