View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10010_low_4 (Length: 236)
Name: NF10010_low_4
Description: NF10010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10010_low_4 |
 | |
|
| [»] scaffold0631 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0631 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: scaffold0631
Description:
Target: scaffold0631; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 174
Target Start/End: Original strand, 6260 - 6433
Alignment:
| Q |
1 |
agcataggataatataatcactgatagcagaaaaaacatatacctggaacacgcaagatgcgtcttttgcaatacactatatcatcacttagattctgcc |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
6260 |
agcataagataatataatcactgatagcagaaaaaacatatacctggaacacgcaagatgtgtctttggcgatacactatatcatcacttagattctgcc |
6359 |
T |
|
| Q |
101 |
atgtattagaccatactacctctggctgcgcaaattgatttgtaaccagcaacgtaaaaaataactttctcata |
174 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
6360 |
atgtcttagaccatactacctctggctgcacaaattgatttgtaaccagcaacgtgacaaataactttctcata |
6433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University