View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10014_high_6 (Length: 272)
Name: NF10014_high_6
Description: NF10014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10014_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 11 - 258
Target Start/End: Original strand, 30239407 - 30239654
Alignment:
Q |
11 |
cataggagtgatggatggtgcttggagttgggaccatagacaaaattggtctttcctactttagtgctaattgttaatgacaaaggaattggacactgac |
110 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30239407 |
cataggagtgatggatggtgcttggagttgggaccatagacaaaaatggtctttcctactttagtgctaattgttaatgacaaaggaattggacactgac |
30239506 |
T |
 |
Q |
111 |
atagcactatatactatattatatatcatgcggtgagtttggtcataggtggtataaaaactcaacccaagtaattggatggtagggttggattgattca |
210 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30239507 |
atagcactatatactatattatatatcatgcggtgagtttggtcataggtggtataaaaactcaacccaagtaattggatggtagggttggattgattca |
30239606 |
T |
 |
Q |
211 |
gtcggtgtcatgaaaagatnnnnnnntaatctgaccgatgaaaatgtt |
258 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
30239607 |
gtcggtgtcatgaaaagataaaaaaataatctgaccgatgaaaatgtt |
30239654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University