View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10014_high_6 (Length: 272)

Name: NF10014_high_6
Description: NF10014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10014_high_6
NF10014_high_6
[»] chr8 (1 HSPs)
chr8 (11-258)||(30239407-30239654)


Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 11 - 258
Target Start/End: Original strand, 30239407 - 30239654
Alignment:
11 cataggagtgatggatggtgcttggagttgggaccatagacaaaattggtctttcctactttagtgctaattgttaatgacaaaggaattggacactgac 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30239407 cataggagtgatggatggtgcttggagttgggaccatagacaaaaatggtctttcctactttagtgctaattgttaatgacaaaggaattggacactgac 30239506  T
111 atagcactatatactatattatatatcatgcggtgagtttggtcataggtggtataaaaactcaacccaagtaattggatggtagggttggattgattca 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30239507 atagcactatatactatattatatatcatgcggtgagtttggtcataggtggtataaaaactcaacccaagtaattggatggtagggttggattgattca 30239606  T
211 gtcggtgtcatgaaaagatnnnnnnntaatctgaccgatgaaaatgtt 258  Q
    |||||||||||||||||||       ||||||||||||||||||||||    
30239607 gtcggtgtcatgaaaagataaaaaaataatctgaccgatgaaaatgtt 30239654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University