View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10014_high_8 (Length: 226)
Name: NF10014_high_8
Description: NF10014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10014_high_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 6 - 187
Target Start/End: Original strand, 13644209 - 13644392
Alignment:
| Q |
6 |
accttgaccatttcctttgttttgtctctaatccatggttttttaggtcgcacttcggtgcctttgtggcgccaaaagcaggtgcctttgacaaaacagg |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| | ||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
13644209 |
accttgaccatttcctttgttttgtctctaatccatggttttttaggccgcacgccagtgcctttgtggcgccaaaggcagatgcctttgacaaaacagg |
13644308 |
T |
 |
| Q |
106 |
ctgtgtcatgtg-ttaagtgctttatattttaataaaata-aaataaagttgatcaaatgggaaatagtgaaatattggtgcgt |
187 |
Q |
| |
|
||||||||||| || ||||| |||||||||||||||| | ||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
13644309 |
ttgtgtcatgtgtttcagtgccttatattttaataaaaaataaataaagttgatcaaacgggaaatagtgaaatattgatgcgt |
13644392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University