View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10014_low_3 (Length: 370)
Name: NF10014_low_3
Description: NF10014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10014_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 7e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 7e-74
Query Start/End: Original strand, 129 - 353
Target Start/End: Original strand, 38014260 - 38014487
Alignment:
| Q |
129 |
caacatactcacaatttgtccacaaaaaacagagaatatattcaaattgctagtcgacaacccaaatacaaggttgcttataagcataacacagtagtgc |
228 |
Q |
| |
|
|||||||||||| | | |||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | |||| |
|
|
| T |
38014260 |
caacatactcacgaatagtccacaaaatacagagaatatattcaaattgctagtcgagaacccaaatacaaggttgcttataagcataacactgaagtga |
38014359 |
T |
 |
| Q |
229 |
tggtacacattaaaataattccacaaagctatccaaattaccaacttgtcatt---nnnnnnncaaaagttttttacttcaaagatgtctgctgcctgcc |
325 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| ||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38014360 |
tggtacacattaaaatacttccacaaagctatccaaattaccaacctgtcattcaaaaacaaaaaaaagatttttacttcaaagatgtctgctgcctgcc |
38014459 |
T |
 |
| Q |
326 |
atctgggattgcaaataacacggttggt |
353 |
Q |
| |
|
|||||||||||||||||||||| ||||| |
|
|
| T |
38014460 |
atctgggattgcaaataacacgattggt |
38014487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University