View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10014_low_5 (Length: 338)
Name: NF10014_low_5
Description: NF10014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10014_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 276; Significance: 1e-154; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 23 - 326
Target Start/End: Complemental strand, 28129902 - 28129599
Alignment:
| Q |
23 |
agaagatcgtgaccgttcgttgcttcatgggatacctgttttgctcaaggacagtattgcaacttttgacaaactcaatactactgcagggtcgtatgca |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| ||||| || ||||| || |||||| |
|
|
| T |
28129902 |
agaagatcgtgaccgttcgttgcttcatgggatacctgttttgatcaaagacagtattgcaacttttgacaaactaaatacaacagcaggttcttatgca |
28129803 |
T |
 |
| Q |
123 |
ttgcttggatcaaaggttccacgtgatgcacacgtggtttcgaagctaagggatgctggtgccattattctggggaaaactagtctcccagagtggtatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28129802 |
ttgcttggatcaaaggttccacgtgatgcacacgtggtttcgaagctaagggatgctggtgccattattctggggaaaactagtctcccagagtggtatg |
28129703 |
T |
 |
| Q |
223 |
gcgctcgttctaccaccatgccaaaaacttggtgcgctagaggtggatttgcattggttagtactcatcacttcactctctcttaatctctaaaataaag |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28129702 |
gcgctcgttctaccaccatgccaaaaacttggtgcgctagaggtggatttgcattggttagtactcatcacttcactctctcttaatctctaaaataaag |
28129603 |
T |
 |
| Q |
323 |
tctc |
326 |
Q |
| |
|
|||| |
|
|
| T |
28129602 |
tctc |
28129599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 20 - 307
Target Start/End: Complemental strand, 28114370 - 28114076
Alignment:
| Q |
20 |
acgagaagatcgtgaccgttcgttgcttcatgggatacctgttttgctcaaggacagtattgcaacttttgacaaactcaatactactgcagggtcgtat |
119 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |||| ||||||||||| |||||||| ||||| ||||| || ||||| || ||| |
|
|
| T |
28114370 |
acgagaagatcgtgaccgttcaatgcttcatgggatacctgttttgatcaaagacagtattgccacttttgataaactaaatacaacagcaggttcttat |
28114271 |
T |
 |
| Q |
120 |
gcattgcttggatcaaaggttccacgtgatgcacacgtggtttcgaagctaagggatgctggtgccattattctggggaaaactagtctcccagagtggt |
219 |
Q |
| |
|
|||||| | ||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| || |||||||||||||||||||| |||||||||| |
|
|
| T |
28114270 |
gcattgttgggatcgaaggttccacgtgatgcgcacgtggtttcgaagctaagggatgctggtgctatcattctggggaaaactagtcttccagagtggt |
28114171 |
T |
 |
| Q |
220 |
atggcgctcgttctaccaccatgc---caaaaacttggtgcgctagaggtggatttgcattggt---tagtactcatcact-tcactctctctta |
307 |
Q |
| |
|
|||| ||||||| | | |||| | || |||||||| ||||||||||||||| ||||| |||||||||||||| ||||||||||||| |
|
|
| T |
28114170 |
atgggattcgttcttcaaaaatgctaggacaagcttggtgccctagaggtggatttggcttggttagtagtactcatcactatcactctctctta |
28114076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University