View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10014_low_7 (Length: 296)
Name: NF10014_low_7
Description: NF10014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10014_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 17 - 122
Target Start/End: Complemental strand, 44869432 - 44869327
Alignment:
| Q |
17 |
ataaacatctttattatcagtcctccatatttgcttatcctcccttcgaccatagatggtgggcacttttccttatctcactcacattcattcaaaacat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44869432 |
ataaacatctttattatcagtcctccatatttgcttatcctcccttccaccatagatggtgggcacttttccttatctcactcacattcattcaaaacat |
44869333 |
T |
 |
| Q |
117 |
cgttta |
122 |
Q |
| |
|
|||||| |
|
|
| T |
44869332 |
cgttta |
44869327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University