View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10015_12 (Length: 321)
Name: NF10015_12
Description: NF10015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10015_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 54 - 313
Target Start/End: Original strand, 44059794 - 44060049
Alignment:
| Q |
54 |
ggtgaaatcttttggaatcgatcctatgaattggaaagaagactttgtgattgattttattagctaggatgggatttaatgtctttccactgtgctgnnn |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44059794 |
ggtgaaatcttttggaatcgatcctatgaattggaaagaagactttgtgattgattttattagctaggatgggatttaatgtctttccactgtgctgttt |
44059893 |
T |
 |
| Q |
154 |
nnnnnnnnnnnacagttcatctaatactttacaccgatagtctcagttgaggtgaaggttaggaaacttgttggccttatgatataaaatatgttttctt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44059894 |
ttttttt----acagttcatctaatactttacaccgatagtcccagttgaggtgaaggttaggaaacttgttggccttatgatataaaatatgttttctt |
44059989 |
T |
 |
| Q |
254 |
tttcatctgggataatatatcatggttataaatgaattatgcagtcaacccgtctctgct |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44059990 |
tttcatctgggataatatatcatggttataaatgaattatgcagtcaacccgtctgtgct |
44060049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 55 - 106
Target Start/End: Complemental strand, 46837911 - 46837860
Alignment:
| Q |
55 |
gtgaaatcttttggaatcgatcctatgaattggaaagaagactttgtgattg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| | |||||||||||||||| |
|
|
| T |
46837911 |
gtgaaatcttttggaatcgatcctatgaaatggtaggaagactttgtgattg |
46837860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 44059738 - 44059776
Alignment:
| Q |
1 |
aaaacaagacccgtacctatttttacttgtgccattgga |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44059738 |
aaaacaagacccgtacctatttttacttgtgccattgga |
44059776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University