View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10015_14 (Length: 301)
Name: NF10015_14
Description: NF10015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10015_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 13 - 192
Target Start/End: Complemental strand, 3097399 - 3097218
Alignment:
| Q |
13 |
atccaaactgatcgaaatacaagttgatgtgggataacccgcattaaccattcatattaatcccacaaaatgacacaaaagtctttgttgaccattatat |
112 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
3097399 |
atccaaattgatcgaaatacaaattgatgtgggataacccgctttaaccattcatattaatcccacaaaatgacacaaaggtctttgttgacc-ttatat |
3097301 |
T |
 |
| Q |
113 |
tgtctccacatatagcacaaagcaattttggat---acaatataagtgacgaatagtaaaaccatgacatcataaccgttatc |
192 |
Q |
| |
|
| |||||||||||||||||||||||||||| || ||||||||| ||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
3097300 |
tatctccacatatagcacaaagcaattttgaatacaacaatataaatgacgaataacaaaaccatgacatcataacccttatc |
3097218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 272 - 301
Target Start/End: Complemental strand, 3097136 - 3097107
Alignment:
| Q |
272 |
tgatgtggcaattgatcattagaaagtaga |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3097136 |
tgatgtggcaattgatcattagaaagtaga |
3097107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000007; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 10 - 108
Target Start/End: Complemental strand, 38943770 - 38943671
Alignment:
| Q |
10 |
tagatccaaactgatc-gaaatacaagttgatgtgggataacccgcattaaccattcatattaatcccacaaaatgacacaaaagtctttgttgaccatt |
108 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |||| | || ||| ||||| ||| ||||||| ||| | ||| |||||||||||||||| |
|
|
| T |
38943770 |
tagatccaaactgatatgaaatacaagttgatgtgggacaacctactttgtccaatcatactaacaccacaaattgataaaaaggtctttgttgaccatt |
38943671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 11 - 107
Target Start/End: Original strand, 38942480 - 38942577
Alignment:
| Q |
11 |
agatccaaactgatc-gaaatacaagttgatgtgggataacccgcattaaccattcatattaatcccacaaaatgacacaaaagtctttgttgaccat |
107 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||| | ||| ||| ||||| ||| ||||||| ||| | || ||||||||||||||| |
|
|
| T |
38942480 |
agatccaaactgatatgaaatacaagttgatgtgggacaacctactttatccaatcatactaacaccacaaattgataagaaggtctttgttgaccat |
38942577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University