View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10016_2 (Length: 327)
Name: NF10016_2
Description: NF10016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10016_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 24 - 308
Target Start/End: Original strand, 47116848 - 47117128
Alignment:
| Q |
24 |
tcatcacttctcaggtaattacaatagttatattttatcaaagatattcaataaccaatttcttttatatctttagtttcaattcaaggagataaatatt |
123 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47116848 |
tcatcgcttctcaggtaattacaatagttatattttatcaaagatattcaataaccaatttcttttatatctttagtttcaattcaaggagataaatatt |
47116947 |
T |
|
| Q |
124 |
cataccttttaacgatcaaatcacaaagcaaggtaagcaatatcaacgtatcaatgactcgatcgatcaccttttaacgattatttttaatttcttgttt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47116948 |
cataccttttaacgatcaaatcacaaagcaaggtaagcaatatcaacgtatcaatgac----tcgatcaccttttaacgattatttttaatttcttgttt |
47117043 |
T |
|
| Q |
224 |
tgtagatggataggcggagaatgtatgataggcaacaaagctcaacgggaacgccaacatcaccatcttcgccggtgatgatgtc |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
47117044 |
tgtagatggataggcggagaatgtatgataggcaacaaagctcaacgggaacgccaacatcaccgtcttcaccggtgatgatgtc |
47117128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University