View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10017_low_3 (Length: 338)
Name: NF10017_low_3
Description: NF10017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10017_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 8e-86; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 119 - 291
Target Start/End: Complemental strand, 48979413 - 48979241
Alignment:
| Q |
119 |
ctaactagtgtttgggaatgaatgagcatttgaaatgagaatgagtttgagaaagattgtacttatgaagagagaaaaagcttagagggatctaaacaga |
218 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
48979413 |
ctaactagtgtttgggaatgattgagcatttgaaatgagaatgagttagagaaagattgtacttatgaagagagaaaaatcttagagggatctaaacaga |
48979314 |
T |
 |
| Q |
219 |
gttgtggctaatacattcttttcttttcaaccaagcttatacacaaccccatgaacctccctactcttttcat |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48979313 |
gttgtggctaatacattcttttcttttcaaccaagcttatacacaaccccatgaacctccctactcttttcat |
48979241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 17 - 70
Target Start/End: Complemental strand, 48979525 - 48979472
Alignment:
| Q |
17 |
attaataatctttattttcttgtatatacttattcttggcaggaaacaattcca |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48979525 |
attaataatctttattttcttgtatatacttattcttggcaggaaacaattcca |
48979472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University