View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10017_low_4 (Length: 319)
Name: NF10017_low_4
Description: NF10017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10017_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 122 - 289
Target Start/End: Original strand, 9223939 - 9224105
Alignment:
| Q |
122 |
aggtgctgtcaacatcttgatattaatagttatggaaggatattttcannnnnnnngttggataattcaatgatatatatagtaattttatcgataattt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9223939 |
aggtgctgtcaacatcttgatattaatagttatggaaggatattttcattttttt-gttggataattcaatgatatatatagtaattttatcgataattt |
9224037 |
T |
 |
| Q |
222 |
tttcatccatatctctctgtttttgatccagcaaagagttttttgttacataaaccatctcaaccaca |
289 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9224038 |
ttgcatccatatctctctgtttttgatccagcaaagagttttttgttacataaaccatctcaaccaca |
9224105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 9223817 - 9223889
Alignment:
| Q |
1 |
ctttcaaatagttatggagggccgtggttattgagatataatgtgcagaaagaaaaagatggaaacaatagtt |
73 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9223817 |
ctttcaaatagttatggagggccatggttattgagatataatgtgcagaaagaaaaagatggaaacaatagtt |
9223889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University